Sequence

AUUGAAAGUGACUACAUCGGGG

Expression details
CountSample IDExperiment title
29GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
15GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
9GSM707691Characterization of AGO1-/AGO4-associated smRNAs
7GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM707683Characterization of AGO1-/AGO4-associated smRNAs
4GSM707685Characterization of AGO1-/AGO4-associated smRNAs
3GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
3GSM707684Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518389MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
2GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings