Sequence

AUCAAUGCAUUGAAAGUGACUA

Expression details
CountSample IDExperiment title
67GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
6GSM707682Characterization of AGO1-/AGO4-associated smRNAs
6GSM707691Characterization of AGO1-/AGO4-associated smRNAs
5GSM707690Characterization of AGO1-/AGO4-associated smRNAs
4GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
3GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
3GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
2GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs