Sequence

ACCCUGGUUUAGUCACUUUC

Expression details
CountSample IDExperiment title
3GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
2GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs