Sequence

AAGUGACUACAUCGGGGUUCCGA

Expression details
CountSample IDExperiment title
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs