Sequence

AAAGUGACUACAUCGGGGUUCCGAUU

Expression details
CountSample IDExperiment title
4GSM707689Characterization of AGO1-/AGO4-associated smRNAs
3GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs