Sequence

AAAGUGACUACAUCGGGGUU

Expression details
CountSample IDExperiment title
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs