UCCCUGUAUGCCACGAGUGGA
| Count | Sample ID | Experiment title |
|---|---|---|
| 5 | GSM554063 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 4 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM304282 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 2 | GSM304284 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 2 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 2 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM304285 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 1 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM554062 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |