Sequence

UAUGCCUGGCUCCCUGUAUGC

Expression details
CountSample IDExperiment title
11GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
9GSM707684Characterization of AGO1-/AGO4-associated smRNAs
6GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
4GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM707691Characterization of AGO1-/AGO4-associated smRNAs
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
2GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
2GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518389MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings