Sequence

UACAAGGAGUCAAGCAUGACC

Expression details
CountSample IDExperiment title
238GSM707685Characterization of AGO1-/AGO4-associated smRNAs
135GSM707691Characterization of AGO1-/AGO4-associated smRNAs
46GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
45GSM707683Characterization of AGO1-/AGO4-associated smRNAs
33GSM707681Characterization of AGO1-/AGO4-associated smRNAs
31GSM707682Characterization of AGO1-/AGO4-associated smRNAs
30GSM707679Characterization of AGO1-/AGO4-associated smRNAs
30GSM707684Characterization of AGO1-/AGO4-associated smRNAs
28GSM707680Characterization of AGO1-/AGO4-associated smRNAs
20GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
17GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
12GSM707678Characterization of AGO1-/AGO4-associated smRNAs
12GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
11GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
10GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
9GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
9GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM707690Characterization of AGO1-/AGO4-associated smRNAs
6GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
5GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
3GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424745smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs