Sequence

GCUCCCUGUAUGCCACGAGUGGA

Expression details
CountSample IDExperiment title
3GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
3GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs