Sequence

GCGUACAAGGAGUCAAGCAUGA

Expression details
CountSample IDExperiment title
7GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0