Sequence

CUGCCGGUGGCGUACAAGGAGUC

Expression details
CountSample IDExperiment title
3GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings