Sequence

CGUACAAGGAGUCAAGCAUGAC

Expression details
CountSample IDExperiment title
3GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings