Sequence

UAUGCCUGGCUCCCUGUAUG

Expression details
CountSample IDExperiment title
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings