Sequence

GAUGACCUCCGUGGAUGGCGUAUG

Expression details
CountSample IDExperiment title
4GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
4GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
1GSM149081Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415793Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415795Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs