AUGACCUCCGUGGAUGGCGUAUG
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM387516 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM415795 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |